Scrub typhus meningitis/meningoencephalitis in Kumaon Region, Uttarakhand

Ritu Rakholia; Vinita Rawat; Rajesh Kumar Singh; Ashok Kumar; Sandip Raj Saxena; Param Jeet Singh; Vivekanand Satyawali

doi:10.4103/jmgims.jmgims_21_19

ORIGINAL ARTICLE

Year : 2021 | Volume : 26 | Issue : 1 | Page : 18-22

Scrub typhus meningitis/meningoencephalitis in Kumaon Region, Uttarakhand

Ritu Rakholia¹, Vinita Rawat², Rajesh Kumar Singh³, Ashok Kumar⁴, Sandip Raj Saxena⁴, Param Jeet Singh⁴, Vivekanand Satyawali⁴
¹ Department of Paediatrics, Government Medical College, Haldwani, Uttarakhand, India
² Department of Microbiology, Government Medical College, Haldwani, Uttarakhand, India
³ Department of Community Medicine, Government Medical College, Haldwani, Uttarakhand, India
⁴ Department of Medicine, Government Medical College, Haldwani, Uttarakhand, India

Date of Submission	29-Mar-2019
Date of Acceptance	24-Feb-2020
Date of Web Publication	29-Jun-2021

Correspondence Address:
Dr. Vinita Rawat
Department of Microbiology, Government Medical College, Haldwani, Nainital, Uttarakhand
India

Source of Support: None, Conflict of Interest: None

Check

DOI: 10.4103/jmgims.jmgims_21_19

Abstract

Background: Scrub typhus is becoming an increasing cause of meningitis/meningoencephalitis in endemic areas. Materials and Methods: We conducted a retrospective chart review to describe epidemiological features, clinical characteristics, laboratory profile, and therapeutic outcomes in scrub typhus, considering meningitis/meningoencephalitis as cases and patients without meningoencephalitis as controls. Results: A total of 97 scrub typhus positive cases confirmed by immunoglobulin M enzyme-linked immunosorbent assay and/or polymerase chain reaction were included in the study. By univariant analysis, risk factors such as exposure to a forest, adolescent age and associated oliguria were significantly higher among cases as compared to the control group. Signs and symptoms that were significantly higher among meningitis/meningoencephalitis cases were conjuctival suffusion, pharyngitis, maculopapular rash, pain in the abdomen, splenomegaly, and altered sensorium. Cerebrospinal fluid (CSF) pictures closely resembled aseptic meningitis. All patients had received doxycycline or azithromycin, and the outcome was favorable in the case group. Conclusion: Scrub typhus meningitis/meningoencephalitis was significantly higher in adolescents. Close observation and great care is essential for adolescent patients with associated risk factors. Prompt treatment ensures survival.

Keywords: Azithromycin, doxycycline, meningoencephalitis, scrub typhus

How to cite this article:
Rakholia R, Rawat V, Singh RK, Kumar A, Saxena SR, Singh PJ, Satyawali V. Scrub typhus meningitis/meningoencephalitis in Kumaon Region, Uttarakhand. J Mahatma Gandhi Inst Med Sci 2021;26:18-22

How to cite this URL:
Rakholia R, Rawat V, Singh RK, Kumar A, Saxena SR, Singh PJ, Satyawali V. Scrub typhus meningitis/meningoencephalitis in Kumaon Region, Uttarakhand. J Mahatma Gandhi Inst Med Sci [serial online] 2021 [cited 2023 Jun 4];26:18-22. Available from: https://www.jmgims.co.in/text.asp?2021/26/1/18/319831

Introduction

Scrub typhus is a zoonotic disease caused by an obligate intracellular Gram-negative bacterium Orientia tsutsugamushi that is transmitted through the bite of the larva of the trombiculid mite.^[1] O. tsutsugamushi enters into monocyte or causes vascular injury due to disseminated vasculitis that involves various organs including the brain.^[2],[3]

In endemic areas, scrub typhus is becoming an increasing cause of meningitis/meningoencephalitis.^{[2],[3],[4],[5]} However, in many areas, scrub typhus still remains underreported and under suspected.^[6],[7]

This study seeks to document the epidemiological findings, clinical features, laboratory parameters and therapeutic outcomes of laboratory confirmed cases of scrub typhus meningitis/meningoencephalitis and compare them with the control group (without meningitis/meningoencephalitis).

Materials and Methods

This study was conducted Dr. Susheela Tiwari Hospital affiliated to Government at the Medical College, Haldwani, which is a tertiary care hospital catering to hilly areas of Kumaon in Uttarakhand, adjoining areas of Uttar Pradesh and Nepal. The study period was from February 2015 to December 2015. Kumaon region of Uttarakhand consists of six districts, namely Nainital, Almora, Udham Singh Nagar (USN), Bageshwar, Pithoragarh, and Champawat. Geographically, Kumaon is divided into three zones. Upper hills include Bageshwar and Pithoragarh. Middle hills include Almora and hill region of Nainital. Foothill includes USN and Haldwani town of Nainital District. Ethical clearance from the Institutional Ethics Committee was obtained prior to the study and informed written consent from patients and guardians in case of children was obtained.

In this study, we enrolled all acute febrile patients in whom dengue, malaria, and enteric fever were ruled out as these diseases share the same epidemiological and clinical features as scrub typhus.

The diagnosis of scrub typhus was confirmed by immunoglobulin M (IgM) enzyme-linked immunosorbent assay (ELISA) and/or by nested polymerase chain reaction (PCR) targeting 47 kDa antigens. IgM antibodies in serum were detected by IgM ELISA (Scrub Typhus Detect IgM ELISA, InBios, USA), and samples with optical density >0.6 for ELISA were considered positive.

Extracted DNA from whole blood using the QIAamp DNA Mini kit (Qiagen, Hilden, Germany) was used as a template for the PCR. PCR targeting the 47 kDa protein was carried out. The conventional PCR targeting the 47-kDa gene was performed in 25 μl reaction volumes containing 2.5 μl of 10X Taq buffer, 2.5 μl of 25 mM MgCl2, 1 μl of 10 mM dNTPs, 1 μl of forward primer (10 pmol/μl) (5'TCCTTTCGGTTTAAGAGGAACA3'), 1 μl, 10 pm/μl reverse primer (5'GCATTCAACTGCTTCAAGTACA3'), 1 μl of template, 0.5 μl Taq DNA Polymerase, 15.5 μl nuclease free water. The PCR conditions consisted of initial denaturation at 95°C for 5 min, followed by 35 cycles, each consisting of denaturation at 95°C for 30 sec, annealing at 54°C for 30 sec, and extension at 72°C for 30 sec. The final elongation step was prolonged for 7 min at 72°C.

Nested PCR for the 47-kDa gene was performed using the first PCR (Conventional PCR) product as the template DNA and 10 pmol/μl of each primer (forward primer (5'AACTGATTTTATTCAACTAATGCTGCT3') and reverse primer (5'TATGCCTGAGATAGATACCTGAATCGA3'). The second-round PCR conditions involved an initial denaturation at 94°C for 5 minutes followed by 30 cycles of denaturation at 94°C for 30sec, annealing at 52°C for 45sec, extension at 72 °C for 45sec and final extension done at 72 °C for 7 minutes. Amplified PCR products (118bp) were detected by 2% agarose gel electrophoresis. Two PCR products were outsourced for sequencing and sequences were deposited to DNA Data Base Japan (DDBJ).

Meningitis/meningoencephalitis was defined by the clinical syndrome of fever, headache, and neck rigidity with or without altered sensorium or seizures with a cerebrospinal fluid (CSF) cell counts more than five cells.

Demographic data, risk factors, clinical features, complications, treatment, and therapeutic outcomes were analyzed from data abstraction form. Statistical analysis was performed using IBM SPSS statistics 19. 9 (Armon, NY:IBM Corp).

All patients in the case group were given supportive management and intravenous ceftriaxone 100 mg/kg initially to cover for septic meningitis as per the protocol which was stopped after positive confirmation of scrub typhus. Younger children <8 years or those with hepatorenal involvement were started on azithromycin and others received doxycycline.

Results

Of the 97 scrub typhus IgM ELISA-positive cases, 60 cases were also positive by nested PCR. Fifteen patients (18.5%) were confirmed with scrub meningitis/meningoencephalitis by IgM ELISA and nested PCR both and an additional three cases were confirmed by IgM ELISA only. Accession number assigned to our isolates by DNA data bank of Japan are- LC169590 and LC169591.

The mean age of patients was 25.73 years in the case group and 31.06 years in the control group [Table 1]. In the present study, by univariant analysis, risk factors such as exposure to forest and adolescent's age and associated complication oliguria were significantly higher in the case group as compared to the control group.

Table 1: Epidemiological findings, clinical characteristics, and laboratory findings of scrub typhus patients with and without meningitis/meningoencephalitis

Click here to view

Sign and symptoms that were significantly higher among meningitis/meningoencephalitis cases were conjuctival suffusion, pharyngitis, maculopapular rash, pain in the abdomen, splenomegaly and altered sensorium [Table 1].

CSF profile of 18 cases is summarized in [Table 2]. All patients had received doxycycline or azithromycin, and the outcome was favorable except in six patients on the control group.

Table 2: Cerebrospinal fluid findings in patients with scrub meningitis/meningoencephalitis

Click here to view

Discussion

Scrub typhus is an acute febrile illness that responds dramatically to antibiotics like doxycycline if diagnosed early. Most of the clinical manifestations in scrub typhus are thought be due to systemic vasculitis, which can be due to direct effect or exaggerated immune response.^[2],[3] Nested PCR study from CSF revealed the direct invasion of scrub typhus in the central nervous system.^[2]

Scrub typhus meningitis/meningoencephalitis in the absence of high index of suspicion and absence of confirmatory tests may be missed as it closely mimics viral meningoencephalitis, malaria, enteric fever and in some cases, pyogenic or tubercular meningitis. The first line of antibiotics used for the treatment of these illnesses does not cover scrub typhus, and the illness may thus be fatal, or administration of rifampicin with false suspicion of tubercular meningitis may bring improvement, but the patient will have to tolerate a long drug therapy and its side effects.^[5]

The incidence of meningitis/meningoencephalitis in scrub typhus has been reported between 9% and 26%.^{[3],[4],[5],[6],[7],[8]} In the present study, scrub typhus meningitis/meningoencephalitis was diagnosed in 18.5% of the patients. Higher incidence (26%) of meningitis has been reported from South India.^[3] Recently, Bhargav et al.^[6] observed encephalopathy in 9% of scrub typhus-confirmed cases.

In an Indian study, the incidence of eschar ranging from 4 to 46% has been reported.^{[2],[3],[6],[7]} In the present study, we found eschar in only 5.5% of cases and 7.1% in the control group.

In the present study, CSF pictures closely resembled aseptic meningitis. Two cases in the control group showed altered sensorium and convulsions. CSF analysis was done in both the cases. However, these two patients had normal CSF findings. Both the patients had acute respiratory distress syndrome (ARDS) and were hypoxemic, so we presumed it to be the cause of altered sensorium and convulsions, especially since the sensorium improved with oxygenation. Hence, these two cases were included in the control group. In a prospective study from Thai children, scrub typhus was found to be the second most common cause of aseptic meningitis after Japanese encephalitis.^[9] Some studies have reported CSF picture resembling tubercular meningitis.^[3],[4]

Renal involvement in the form of oliguria was significantly higher in the case group, but none of the patient in this group needed dialysis. Vishwanathan et al.^[3] also observed higher renal involvement in meningitis cases. Others have reported hepatitis and pneumonia as a major complication in meningitis/meningoencephalitis.^[10] Cardiovascular involvement in the form of shock needing inotropic support was seen only in one child with associated ARDS.

In a South Indian study, the maximum number of scrub meningitis admissions were in the month of February. In our study, maximum meningitis/meningoencephalitis admissions (15/18) were between August and September. Compared with the control group, there was no case fatality in meningitis/meningoencephalitis cases during the study period. Brisk recovery in scrub meningitis/meningoencephalitis was with appropriate therapy that has been reported from South Indian studies.^[3],[8] On the contrary, some studies have noticed a high mortality rate.^[11],[12]

Our study showed a favourable outcome with no mortality, probably due to high index of suspicion and ready availability of laboratory results, prompting clinician to initiate specific therapy in form of doxycyline or azithromycin timely. However, the difference of virulence among various serotypes in different geographical areas and their predilection for different organs cannot be ruled out and requires further studies to confirm this hypothesis.

Conclusion

Scrub typhus meningitis/meningoencephalitis should be an an important differential diagnosis in patients with aseptic meningitis/meningoencephalitis with thrombocytopenia and raised aminotranferase, more so in adolescent with risk factors presenting in rainy season. Prompt treatment ensures survival. The limitation of our study was that since it is a hospital-based study, selection bias could not be avoided.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

References

1.	Rathi N, Rathi A. Rickettsial infections: Indian perspective. Indian Pediatr 2010;47:157-64.
2.	Pai H, Sohn S, Seong Y, Kee S, Chang WH, Choe KW. Central nervous system involvement in patients with scrub typhus. Clin Infect Dis 1997;24:436-40.
3.	Viswanathan S, Muthu V, Iqbal N, Remalayam B, George T. Scrub typhus meningitis in South India-a retrospective study. PLoS One 2013;8:e66595.
4.	Abhilash KP, Gunasekaran K, Mitra S, Patole S, Sathyendra S, Jasmine S, et al. Scrub typhus meningitis: An under-recognized cause of aseptic meningitis in India. Neurol India 2015;63:209-14. [PUBMED] [Full text]
5.	Varghese GM, Mathew A, Kumar S, Abraham OC, Trowbridge P, Mathai E. Differential diagnosis of scrub typhus meningitis from bacterial meningitis using clinical and laboratory features. Neurol India 2013;61:17-20. [PUBMED] [Full text]
6.	Bhargava A, Kaushik R, Kaushik RM, Sharma A, Ahmad S, Dhar M, et al. Scrub typhus in Uttarakhand adjoining Uttar Pradesh: Seasonality, clinical presentations predictors of mortality. Indian J Med Res 2016;144:901-9. [PUBMED] [Full text]
7.	Rawat V, Singh RK, Kumar A, Saxena SR, Varshney U, Kumar M. Epidemiological, clinical and laboratory profile of scrub typhus cases detected by serology and RT-PCR in Kumaon, Uttarakhand: A hospital-based study. Trop Doct 2018;48:103-6.
8.	Varghese GM, Trowbridge P, Janardhanan J, Thomas K, Peter JV, Mathews P, et al. Clinical profile and improving mortality trend of scrub typhus in South India. Int J Infect Dis 2014;23:39-43.
9.	Silpapojakal K, Varachit B. Paeditric scrub typhus in Thailand: A study of 73 confirmed cases. Trans R Soc Trop Med Hyg 2004;98:354-9.
10.	Jim WT, Chiu NC, Chan WT, Ho CS, Chang JH, Huang S Y et al. clinical manifestations laboratory finding and complications of paediatric scrub typhus in eastern Taiwan. Pediatr Neonatol 2009;50:96-101.
11.	Kim DM, Chung JH, Yun NR, Kim SW, Lee JY, Han MA, et al. Scrub typhus meningitis or meningoencephalitis. Am J Trop Med Hyg 2013;89:1206-11.
12.	Bhat NK, Pandita N, Saini M, Dharm, Ahmed S, Shiragu N, et al. Scrub typhus: A clinico –laboratory differentiation of children with and without meningitis. J Trop Pediatr 2016:62;194-9.